Question A firm's demand function is = 60 - 0.5Qif fixed costs are 10 and variable costs are Q+ 3 per unit, find the macmum profit 532 530 531 534 Please deutils and clear OP

= Let Ô = d/dx (the derivative operator). Find (a) (sinD)x5 (b) (7-62) cos(x) 1 Reading: Occasionally we shall work on functions of operators. They are typically defined by the power series expansion.

Show all work and explain. The rigid bar is supported by the two short white spruce wooden posts and a spring. 50 kN/m А с B k 1 m -1 m -1 m Part A If each of the posts has an unloaded length of 1 m and a cross-sectional area of 850 mm² , and the spring has a stiffness of k = 4 MN/m and an unstretched length of 1.02 m , determine the force in each post after the load is applied to the bar. Express your answer to three significant figures and include appropriate units.

Sheila Williams, a medical secretary, earns $2,548 monthly for a 34-hour week. For overtime work, she receives extra pay at the regular hourly rate up to 40 hours and time and one-half beyond 40 hours in any week. During one semimonthly pay period, Williams worked 10 hours overtime. Only 2 hours of this overtime were beyond 40 hours in any one week. Compute the following amounts. Round all divisions to two decimal places and use the rounded amounts in subsequent computations. Round your final answers to the nearest cent. a. The regular semimonthly earnings $fill in the blank 1 b. The overtime earnings $fill in the blank 2 c. The total earnings $fill in the blank 3

Mr. Smith has saved $1,800 each year for 20 years. A year after the saving period ended, Mr. Smith withdrew $7,500 each year for a period of 5 years. In the sixth and seventh years, he only withdrew $5,000 per year. In the eighth year, he decided to withdraw the remaining money in his account. If the interest rate was 6% per year throughout the whole period, what was the amount he withdrew at the end of the eighth year? w

Please write each number in front of the resultthank you. Shelly and Kelly Macdonald met up with Sarah and Tara MacNeill to go fishing in Cape Breton. They found two pools in a stream containing speckled trout (assume equal variance), with the Macdonalds at one pool and the MacNeills at the other, and at the end of the day each team had caught (and released unharmed) 5 fish. For each fish they recorded the length and weight, and the data on length (in cm) is summarized below (Give the answers to 2 places past decimal) Team Mean Sed. Dev Macdonald 19 1.4 MacNeill 2141 2 a.) To test whether or not the fish have the same mean size in the two pools, the null hypothesis will be: HO: 11-42 -2.41 HO: -2 -2.41 HO: 12-0 HO: -20 Tries 0/1 b.) The alternative hypothesis for this test will be: Ha: 1-2.-241 Ha1.22.41 Ma120 Hai 1-120 Tres 0/1 c.) What in the pooled estimate of the variance? ** Trys d.) Compute the value of the test statistic WOH Tries 0/5 e) Find bounds on the value for the test. P<.001 01 <P < .05 05 P1 P>.1 f) Is there statistically significant evidence against HO at a = 0.05 ? Yes No Not enough information to decide #*** Tries 0/1 g.) Calculate the 95% confidence interval for the difference in mean length Lower: Upper:

1.The Longest Common Subsequence Problem implement the Longest Common Subsequence (LCS) problem using dynamic programming. Input: two DNA sequences Adenine (A), Guanine (G), Cytosine (C) and Thymine (T) Output: the Longest Common Subsequence (LCS) of the input sequences Test data example) S1=ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S2=GTCGTTCGGAATGCCGTTGCTCTGTAAA S3=GTCGTCGGAAGCCGGCCGAA programming language is c or java