Question Use the following information to answer this question. Windswept, Inc.2017 Income Statement($ in millions)Net sales$9,750 Cost of goods sold 7,800 Depreciation 355 Earnings before interest and taxes$1,595 Interest paid 94 Taxable income$1,501 Taxes 450 Net income$1,051    Windswept, Inc.2016 and 2017 Balance Sheets($ in millions)  2016  2017   2016  2017 Cash$250 $270 Accounts payable$1,480 $1,732 Accounts rec. 1,050  950 Long-term debt 1,040  1,228 Inventory 1,720  1,630 Common stock 3,300  3,000 Total$3,020 $2,850 Retained earnings 620  870 Net fixed assets 3,420  3,980        Total assets$6,440 $6,830 Total liab. & equity$6,440 $6,830   Windswept, Inc., has 520 million shares of stock outstanding. Its price–earnings ratio for 2017 is 20. What is the market price per share of stock?  

Share More (Pty) Ltd is considering expanding its current share portfolio investments to mitigate its risk profile. The company’s management consider themselves conservative investors with an expected return of 15%. The financial manager knows that you have passed your Financial Management and asked you to assist him with the calculations. The manager collected the following information for the purposes of evaluating the different risks and returns: Company Expected return Standard deviation Impahla 14% 4.2% Khula 17% 3.5% Umvuzo 18% 2.1% The covariance between Impahla and Khula is 0.01 and the covariance between Impahla and Umvuzo is 0.0. Required: Note: Show all calculations and round off your answers to two decimals. 4.1 Calculate the portfolio return and standard deviation for the portfolio consisting of 50% of Impahla and 50% of Khula shares. 4.2 Calculate the portfolio return and standard deviation for the portfolio consisting of 40% of Impahla and 60% of Umvuzo shares 4.3 Considering your calculations above, in which one of the two-share portfolios identified above should Share More (Pty) Ltd invest?

Please write each number in front of the resultthank you. Shelly and Kelly Macdonald met up with Sarah and Tara MacNeill to go fishing in Cape Breton. They found two pools in a stream containing speckled trout (assume equal variance), with the Macdonalds at one pool and the MacNeills at the other, and at the end of the day each team had caught (and released unharmed) 5 fish. For each fish they recorded the length and weight, and the data on length (in cm) is summarized below (Give the answers to 2 places past decimal) Team Mean Sed. Dev Macdonald 19 1.4 MacNeill 2141 2 a.) To test whether or not the fish have the same mean size in the two pools, the null hypothesis will be: HO: 11-42 -2.41 HO: -2 -2.41 HO: 12-0 HO: -20 Tries 0/1 b.) The alternative hypothesis for this test will be: Ha: 1-2.-241 Ha1.22.41 Ma120 Hai 1-120 Tres 0/1 c.) What in the pooled estimate of the variance? ** Trys d.) Compute the value of the test statistic WOH Tries 0/5 e) Find bounds on the value for the test. P<.001 01 <P < .05 05 P1 P>.1 f) Is there statistically significant evidence against HO at a = 0.05 ? Yes No Not enough information to decide #*** Tries 0/1 g.) Calculate the 95% confidence interval for the difference in mean length Lower: Upper:

1.The Longest Common Subsequence Problem implement the Longest Common Subsequence (LCS) problem using dynamic programming. Input: two DNA sequences Adenine (A), Guanine (G), Cytosine (C) and Thymine (T) Output: the Longest Common Subsequence (LCS) of the input sequences Test data example) S1=ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S2=GTCGTTCGGAATGCCGTTGCTCTGTAAA S3=GTCGTCGGAAGCCGGCCGAA programming language is c or java

Shelly and Kelly Macdonald met up with Sarah and Tara MacNeill to go fishing in Cape Breton. They found two pools in a stream containing speckled trout (assume equal variance), with the Macdonalds at one pool and the MacNeills at the other, and at the end of the day each team had caught (and released unharmed) 5 fish. For each fish they recorded the length and weight, and the data on length (in cm) is summarized below (Give the answers to 2 places past decimal) Team Macdonald MacNeill Mean 18.1 20.35 Std.Dev 1.4 1.9 a.) To test whether or not the fish have the same mean size in the two pools, the null hypothesis will be: HO: 1-X 2 = -2.25 HO: p1-y2 = -2.25 HO: X 1-8 2 = 0 HO: 1-2 = 0 # Tries 0/1 b.) The alternative hypothesis for this test will be: Ha: * 1- 2 = -2.25 Ha: p1-12 + -2.25 Ha: 81-X 2 = 0 Ha: p1-42 = 0 1236 Tries 0/1 c.) What is the pooled estimate of the variance? 1202 Tries 0/5 d.) Compute the value of the test statistic. 1 Tries 0/5

A 50-g weight is hung at the 20-cm mark of a meterstick and a 100-g weight is hung at the 70-cm mark. At what point must the meterstick be supported for it to be in rotational equilibrium? The weight of the meterstick is negligible. O at the 56.67-cm mark. at the 46.67 cm mark. O at the 53.33-cm mark. O at the 43.33 cm mark.

​​​​​​​ The bar has a cross-sectional area of \( 1900 \mathrm{~mm}^{2} \) and \( E=250 \mathrm{GPa} \). (Figure 1) Determine the displacement of its end \( A \) when it is subjected to the distributed loading. Express your answer to three significant figures and include the appropriate units. Enter negative value in the case of contraction and positive value in the case of elongation. Figure 1 of 1 X Incorrect; Try Again; 4 attempts remaining